Sequence
atgataattaagaaagatattttgttaaatgaagagctgattgtcgatgatgatcttaaagtgggtaaagtagagaaggtcaatattgatattctgtcacccagctcagtcattgttagtctgaatattttaggcgtagttgatgattttcatctattactagttgatgataaagataaagataagattgtgctgctctatctttctcttttacgtgttcttcatgaaaaattagatgtaaaagtaaaagtcgcaaaaagtaaacttactaagataaaatatatagtaggtgttgaaatttaa
CipB is a surface-associated partner protein that specifically recognizes and binds defined domains of the outer-membrane adhesin CipA. Through this interaction, CipB stabilizes the CipA scaffold and contributes to the formation of structured adhesive assemblies. Its modular binding capacity allows CipB to function as a ligand that anchors additional functional components to the CipA backbone. In metabolic engineering, CipB can be exploited as the primary docking element in a CipA–CipB scaffold system, enabling the strategic positioning of sequential enzymes and thereby supporting channel-like transfer of metabolic intermediates between consecutive catalytic steps [340].
| Gene size: | |
| Protein size: | |
| Compounds affected | L-histidine |
Databases
| EraGene: | 2197878 |
|---|---|
| KEGG: | plu:plu0157 |